Primer design

Human beta globin region on chromosome 11

Accesion number: U01317.1

IVSI-5(G-C)

Designed Primers

 Forward primer

• 5’ ACCTCACCCTGTGGAGCCAC 3’

 
        LENGTH                   20
        C+G%                     65
        Molecular weight:        6103.585
        Tm:                 57.9 °C

Reverse primer

• (WT)  5’ GATCA₈CCTGTCTTGTAACCTTGATAC 3’

 
        LENGTH                   33
        C+G%                     33.3
        Molecular weight:        10169.71
        Tm:                 58.2 °C

• (MT2) 5’ CCTGTCTTGTAACCTTGATAGCAAC 3’

        LENGTH                   25

        C+G%                     44

        Molecular weight:        7672.77

        Tm:                 56 °C

Size of amplicon

WT: Forward + reverse (WT) = 276 + 12 (GATCA₈) = 288bps

MT2: Forward + reverse (MTS) = 276 bps

 

Do you know him >> Caenorhabditis elegan?

This round worm has won many nobel prizes in the past until now due to its sophisticated complex structures which is quite similar to the human physiological system. Interesting right?

White or red wine? Tannins make it matter.

White wines are made from white grapes or black grapes. After separating the grape’s skins from the juice, it is crushed and the yeast should be added into the juice for fermentation. After filtering, the wine is aged by storing it in stainless steel or oak containers, followed by being bottled after a few months. White wines can be made without skins or seeds so that to make the fermented grape juice. It has light character and crisp fruit flavors, sweet taste with aromas. Examples of white wines are Chardonnay, Pinot Grigio/Pinot Gris, Riesling, and Sauvignon Blanc.

Red wine is usually made from red or black grapes. After the grapes have been crushed, the red grapes with skins undergo fermentation for one to two weeks. The skins which rise to the surface of the mixture are mixed back into the fermenting juice (must). After taking the new wine, “free run” juice is poured and the rest of the “must” is squeezed into “press wine”. The wine is purified and then stored in oak containers for months until ready to be bottled. The oak containers will add additional wood tannins and flavors to the wine, intensifying it by adding rich flavors with spicy, herby and meaty characteristics. Examples of the red wines are Beaujolais, Cabernet, Sauvignon, Chianti, Merlot, Pinot Noir and Zinfandel .

       The main difference between red and white wines is the amount of tannins present in the grape skins. Red wines have more of tannins than white wines, making it deep color, flavor of red wine, slightly bitter taste and dry puckery sensation.

 

RNA interference (RNAi)

RNA interference is a process of gene silencing that plays an important role in development and maintenance of the genome. The RNAi pathway is complex. It is initiated by the enyzme dicer which cleaves double stranded RNA (dsRNA) into 20-25 bp fragments. An RNA-induced silencing complex (RISC) is then formed by base pairing between complementary mRNA and 1 of the 2 strands of each new fragment. This formation of the RISC complex is followed by degradation of the complementary mRNA by the endonuclease argonaute. Argonaute is the catalytic component of the complex. The short 20-25 bp fragments are known as small interfering RNA (siRNA) when they are artificially introduced and microRNA (miRNA) when they are produced endogenously. RNA interference has become a valuable research tool since it allows the prevention of translation of specific genes by introducing siRNA complementary to the mRNA one wishes to suppress.

 

Laboratory Extraction of human DNA

                                       

Yea…. this is the specially modified toolkit of Wizard SV for DNA extration.

By incoporating the minicolum and the appendorf or collection tube, the unwanted substances can be filtered and eluted out from the sample in order to get the pure DNA reading. The surface of the minicolumn has tiny pores and is positively charged. Thus, the negatively charged DNA genome will bind to the column readily.

Compare to the conventional method, it is faster and more efficient.  

“Spaceship” minispin

                

i like this machine, it is called minicentrifuge machine, from Eppendorf company. We use it for centrifuge the buccal cell extraction from the subjects. By this way, it enables the DNA genome extraction, which allow the estimation of the DNA concentration and purification in the human buccal cells.

                          

The insider of the machine is made by metal, which are the cap and the site for appendorf placement.

 

Share your Knowledge

Do you all really follow this kind of strategic approach?

Growing Blood Vessel and Healing wounds by Hair Follicles Stem Cells?

Research by Stelios Andreadis has produced this smooth muscle progenitor cell derived from a hair follicle, which expresses calponin (in red), a marker for smooth muscle cells. The cell nucleus is shown in blue. For a rich source of stem cells to be engineered into new blood vessels or skin tissue, clinicians may one day look no further than the hair on their patients’ heads, according to new research published earlier this month by University at Buffalo engineers.

L Saved The World…

My first thought  about this movie is, it may probably be about the fights between the crushess and some strategical combats as preceding two episodes. But, surprisingly, this time L plays an important role in rescuing the world, preventing the sudden biowalfare destruction. The movie is relevance to technology that involved the new virus revolution and unfortunately it is then evolved to be conversely resistance to the antidote that is previously made. Finally, L found the solution for this, Midkine which can kill the proliferative and destructive virus. However, something really wrong happened……watch the movie then you will know the ending…     

A New screening revolution using F1-ATPase

        Frasch and his colleagues show that the enzyme can be armed with an optical probe (gold nanorod) and manipulated to emit a signal when it detects a single molecule of target DNA. This is achieved by anchoring a quiescent F1-ATPase motor to a surface. A single strand of a reference biotinylated DNA molecule is then attached to its axle. The marker protein, biotin, on the DNA is known to bind specifically and tightly to the glycoprotein avidin, so an avidin-coated gold nanorod is then added. The avidin-nanorod attaches to the biotinylated DNA strand and forms a stable complex.